
RT-PCR primer process

miRNA RT primer PCR reverse primer PCR forward primer
hsa-let-7a cgcatatcgcgtcattacagaaactatacaa gcggagttgaggtagtaggttg tcgcatatcgcgtcattacaga
hsa-let-7b gcgacggagctacatatttgaaaccacaca gtgactggtgaggtagtaggttg tgcgacggagctacatatttga
hsa-let-7c gtgcgagatcgttgtactgaaccatacaa cgtcttcctgaggtagtaggttg ctggtgcgagatcgttgtactg
hsa-let-7g ggaggcgatataatcggctgactgtacaaa agtgctgctttgaggtagtagttt atggaggcgatataatcggctg
hsa-let-7i gatgcccgttagtttgccacagcaca gagagctgtgaggtagtagtttgt gattgatgcccgttagtttgcc
hsa-mir-1 ctcgacaaacgtctaaatgcttacatacttc ccagtggagctggaatgtaaagaa gctcgacaaacgtctaaatgct
hsa-mir-101 cgcatgaatacgccaaacaacttcagttat ccagcggttacagtactgtgata ctcgcatgaatacgccaaacaa
hsa-mir-103 cctggttcgatgtcctagagttcatagccc ggttgacagcagcattgtacag tcctggttcgatgtcctagagt
hsa-mir-106a tgatgcagtctacgctgtcgctacctgc atcccacaaaagtgcttacagtg caatgatgcagtctacgctgtc
hsa-mir-106b gtgcagtataggtacggctatctgcact ccgcgtaaagtgctgacagt atcgtgcagtataggtacggct
hsa-mir-107 tggcgtttcgtcagagatgtgatagccc gtcgtgagcagcattgtacag tcttggcgtttcgtcagagatg
hsa-mir-10a gcttgtcggttaaacactgtcacaaattcg ccggtactaccctgtagatccg aggcttgtcggttaaacactgt
hsa-mir-10b gcacgagacttacggaggaacaaattcg ttggagttaccctgtagaaccg taagcacgagacttacggagga
hsa-mir-122a cgcgtttaaccgagatttaccacaaacacc catggcatggagtgtgacaatg ccgcgtttaaccgagatttacc
hsa-mir-125a cctcacaacgattccacaagcacaggtta gttgattctccctgagacccttta gtcctcacaacgattccacaag
hsa-mir-125b gcaaccttgcgactataaccatcacaagtta gtttcctctccctgagacccta ggcaaccttgcgactataacca
hsa-mir-126 gctcgacctcggaaactatggcattattac agcatgaatcgtaccgtgagt ctgctcgacctcggaaactatg
hsa-mir-126* gcggaactttacgatacggcgcgtacc ggcttcggcattattacttttggt tacgcggaactttacgatacgg
hsa-mir-127 gaaacacctgcgagattcacagccaagc tttgttacatcggatccgtctga tggaaacacctgcgagattcac
hsa-mir-128b catccggctatgcgtattggaaagagacc tggcgtcacagtgaaccg cctcatccggctatgcgtattg
hsa-mir-129 cgcgacatttagatgcgtggcaagccc gtgacactttttgcggtctgg caacgcgacatttagatgcgtg
hsa-mir-130a gaggcgactgcctaaactatgcccttt gccagccagtgcaatgttaaaa tactgaggcgactgcctaaact
hsa-mir-133b tccatcccgatcttctagcatagctggtt cggagttattggtccccttcaa catccatcccgatcttctagca
hsa-mir-135a ccctgctcgcagtatttgagtcacatagga gcggcagtatggctttttattcc aaccctgctcgcagtatttgag
hsa-mir-135b ctgccgctggaacaatttcacataggaa cctcccgtttatggcttttcattc ctaactgccgctggaacaattt
hsa-mir-136 cgacccgcgacttactaatagtccatcatc tgcagcactccatttgttttga acgacccgcgacttactaatag
hsa-mir-137 tcctcaggtcgaacctattgctacgcgt ccgacgctattgcttaagaatacg gctcctcaggtcgaacctattg
hsa-mir-140 gatcgcacggacaactttcctaccatagg gcaccgagtggttttaccct ctagatcgcacggacaactttc
hsa-mir-141 cgccaggataaattgacgcaccatctttac ccgccttaacactgtctggta atcgccaggataaattgacgca
hsa-mir-142-3p cttgcatagtgcgcgtaataatccataaagt ggaatccctgtagtgtttcctact ccttgcatagtgcgcgtaataa
hsa-mir-143 tcgtcgagataagctgtgtgtgagctaca gttcgctgagatgaagcactg gctcgtcgagataagctgtgtg
hsa-mir-145 acttcgcaactaccgtttgaagggattc gtaggaggtccagttttcccag tgaacttcgcaactaccgtttg
hsa-mir-146a ccgaatcttgccatacgcaaacccatgg cggagtctgagaactgaattcca taaccgaatcttgccatacgca
hsa-mir-146b tgactcgcccataacgataaagcctatgg tgaacgtgtgagaactgaattcca gctgactcgcccataacgataa
hsa-mir-148a ccgttcacgatccaaagacacaaagttct cctcgcttcagtgcactacag caaccgttcacgatccaaagac
hsa-mir-149 cgtgattcgtgctcgtatatcggagtgaag catcctttctggctccgtgt gcgtgattcgtgctcgtatatc
hsa-mir-155 ccagaaaccgatcagagtgtcccctatca cgccatgtttaatgctaatcgtga ttccagaaaccgatcagagtgt
hsa-mir-15a ccctatcggttcgagacaccacaaacca ggaatcctgtagcagcacataatg ctaccctatcggttcgagacac
hsa-mir-16 cctttgaggttggtactacggcgccaatat gtgcagtagcagcacgtaaat acctttgaggttggtactacgg
hsa-mir-17-3p ggacttcgcccgataactacaagtgcc agcttgaatttactgcagtgaagg aagaggacttcgcccgataact
hsa-mir-17-5p gccctccttccaacatagtactacctgc accctccaaagtgcttacagtg cttgccctccttccaacatagt
hsa-mir-181a tgaacgtaactcgaatccgtactcaccg cgtccaacattcaacgctgtc cgtgaacgtaactcgaatccgt
hsa-mir-181b acgacctctatgcggatgcccaccg tgcactctaacattcattgctgtc caagacgacctctatgcggatg
hsa-mir-183 agctccgtagtcaggatgacacagtgaattc gtacgctatggcactggtaga agctccgtagtcaggatgaca
hsa-mir-18a cgcgcctactttatgatggtatctgcac aatcgcctaaggtgcatctagt gtccgcgcctactttatgatgg
hsa-mir-191 cctacgacgcagtaaatcacagctgctt gaacacacaacggaatcccaaaa tccctacgacgcagtaaatcac
hsa-mir-192 gcgtatcaccgtgtttactgtggctgtca gcccgtatctgacctatgaattga agcgtatcaccgtgtttactgt
hsa-mir-193b gactcagctcgtttgtgatgaaagcggg aggtaaactggccctcaaagt ctgactcagctcgtttgtgatg
hsa-mir-195 gtgtaggcccaataccagagccaatattt tgccacttagcagcacagaaa ggagtgtaggcccaataccaga
hsa-mir-196a gtcagaaggaatgatgcacagccaacaaca acctgcgtaggtagtttcatgt cgtcagaaggaatgatgcacag
hsa-mir-199a aaggcgattgatacgagtcagaacaggta ggtctccccagtgttcagacta agaaggcgattgatacgagtca
hsa-mir-199a* cccactcatagcgatttgctaaccaatgt ggtagcctacagtagtctgcac atcccactcatagcgatttgct
hsa-mir-19a gataacggcaccgatctacttcagttttgc agcctgtgtgcaaatctatgc aggataacggcaccgatctact
hsa-mir-19b ccctaccgcgcaataaacttcagttttgc ccgctgtgcaaatccatgc aatccctaccgcgcaataaact
hsa-mir-200a acgccacaattaacaagccacatcgttac gccgtctaacactgtctggta cctacgccacaattaacaagcc
hsa-mir-200c gctggcgaattagtagaccaccatcattac ccaacgtaatactgccgggt ctgctggcgaattagtagacca
hsa-mir-202 agcctgtatcggaaattgctttttcccatg acacgacttagaggtatagggca ggagcctgtatcggaaattgct
hsa-mir-203 aagcagtgatccggtctacctagtggtc ggcgtaacgtgaaatgtttaggac actaagcagtgatccggtctac
hsa-mir-204 cacattagcgcgtattcagacaggcatagg ccactttgattccctttgtcatcc ccacattagcgcgtattcagac
hsa-mir-205 tccgtcgttctaatgcgaacagactccg cctccatccttcattccaccg gtttccgtcgttctaatgcgaa
hsa-mir-206 acgagtttagagccggatagccacacac gcgttgtctggaatgtaaggaagt tgacgagtttagagccggatag
hsa-mir-20a ttcatttgttagcgagcggctacctgca cgccatgtaaagtgcttatagtgc cgattcatttgttagcgagcgg
hsa-mir-21 cactgtctagcacgacactaatcaacatcag gccaggcatagcttatcagactg ccactgtctagcacgacactaa
hsa-mir-210 cggtgtaggttcgtgattgactcagccgc acgtactgtgcgtgtgaca ccggtgtaggttcgtgattgac
hsa-mir-212 gtcggaggaacgtagaagtggccgtg ctcacgtaacagtctccagtca atcgtcggaggaacgtagaagt
hsa-mir-214 gctaaattcataaccggccaactgcctgt actcacacagcaggcaca cgctaaattcataaccggccaa
hsa-mir-215 tccacgtcgatgatccctgtctgtcaa gtcgccgtatgacctatgaattg cctatccacgtcgatgatccct
hsa-mir-218 ggtcgaacgcctaacgtcacatggttag cgagtgcatttgtgcttgatcta taatggtcgaacgcctaacgtc
hsa-mir-220 ggaggctcggtattcttgttgaaagtgtcag gctgaagccacaccgtatctg aggaggctcggtattcttgttg
hsa-mir-221 ccagtccacgatagtcccttgaaacccag agtaggaaagctacattgtctgct aaccagtccacgatagtccctt
hsa-mir-222 ccacgacatagcggttacaagagacccag tgacacaagctacatctggctac gaccacgacatagcggttacaa
hsa-mir-223 aggcgtcgagcttaatgtcggggtatttg cgtagccctgtcagtttgtcaa tctaggcgtcgagcttaatgtc
hsa-mir-224 gtaagcacgctacatcctgataaacggaac cgtttgccaagtcactagtggt ttgtaagcacgctacatcctga
hsa-mir-24 gcacatgactcgtagatacggctgttcctg tgcgtggctcagttcagc cgcacatgactcgtagatacgg
hsa-mir-25 gcatactccgaccgttacttcagaccg ggtgccattgcacttgtctc tcagcatactccgaccgttact
hsa-mir-26a accacacgtcatgtgactgcctatcct agcgttgtttcaagtaatccagg atcaaccacacgtcatgtgact
hsa-mir-26b cttagcgttgcgatcttctcaacctatcct ggccgcttcaagtaattcagg tgcttagcgttgcgatcttctc
hsa-mir-27b cggctaactaaccacgattctgcagaactt ctttgtttccttcacagtggctaa ccggctaactaaccacgattct
hsa-mir-29b caagccctagtattcctcgacaacactgatt agctccgtatagcaccatttgaaa gcaagccctagtattcctcgac
hsa-mir-30a-5p gcttgctcggtattagcctcttccagtc agacaacgtgtaaacatcctcga aatgcttgctcggtattagcct
hsa-mir-30b gtcgagattgttgacgccagctgagtg cggtgcattgtaaacatcctacac gtatgtcgagattgttgacgcc
hsa-mir-30c ttacggcgcttagtatcactgctgagagt tggctccttgtaaacatcctacac agttacggcgcttagtatcact
hsa-mir-31 acgaacggcgtcatgtaacagctatgc actccggcaagatgctgg gagtacgaacggcgtcatgtaa
hsa-mir-32 tctaccaaacgccaaacctgcaacttag acggtggagtattgcacattacta tgttctaccaaacgccaaacct
hsa-mir-328 caccgtgtgcaattagaaggacggaagg gctactggccctctctgc ctcaccgtgtgcaattagaagg
hsa-mir-34a gcagcgaatccacgattagaacaaccag gaatggtggcagtgtcttagc ggagcagcgaatccacgattag
hsa-mir-34c cccatccctcactaagtgttggcaatcagc tgcgaaggcagtgtagttagc gcccatccctcactaagtgttg
hsa-mir-372 tgactgcattcaagctcccacgctcaa cgataggaaagtgctgcgacat aagtgactgcattcaagctccc
hsa-mir-373 ggcgattcaacgatctatcacacacccca gctttcagaagtgcttcgattttg cggcgattcaacgatctatcac
hsa-mir-376a gccaagttaggtccattcgtacgtggatt gcacagtgcatcatagaggaaaat atgccaagttaggtccattcgt
hsa-mir-7 agcattcgtctcgacacagcaacaaaatc tgactctgctggaagactagtgat tagagcattcgtctcgacacag
hsa-mir-9 gttccaacccgactatctcatcatacagc gccgtgtctttggttatctagc tggttccaacccgactatctca
hsa-mir-92 gccgtcgaggaatcctatcacaggccg cgctcttattgcacttgtccc gagccgtcgaggaatcctatca
hsa-mir-96 cgtaccgagccttatcgtaagcaaaaatgt ccgcttttggcactagcac gtcgtaccgagccttatcgtaa
hsa-mir-98 ggcgtaataatcgctccattcaacaatacaa cgcaagaagtgaggtagtaagttg cggcgtaataatcgctccattc
hsa-mir-99a cgttggttgtcccatagactcacaagatc ggcaaacccgtagatccga tccgttggttgtcccatagact

